1. During the process of electrophoresis, the ________ functionslike a molecular sieve, separating the samples according to theirsize.
A) agarose gel
B) sample mixture
C) positively charged electrode
D) negatively charged electrode
2. The restriction enzyme SacI has a recognition sequence ofGAGCT^C, where the caret (^) indicates the cut site. Examine theDNA molecule below.
AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if youtreated the above DNA molecule with SacI?
A) four
B) three
C) five
D) two
3. The restriction enzyme BamHI recognizes the DNA sequenceGGATCC and always cuts between the two G nucleotides. How manybases long is the sticky end of a DNA molecule that has been cutwith BamHI?
A) four
B) three
C) five
D) two
