1. Explain how RNAi could be used to treat disease.
2. What are two specific ways in which RNAi can block theproduction of proteins.
3. RNAi exerts its effect by mainly controlling whichprocess?
a. Termination
b. Translation
c. Transcription
d. Replication
e. Splicing
4. Which of the following is not true about miRNA?
a. One miRNA may match multiple targets
b. miRNA is used by scientist as a therapy
c. miRNA is found in plants and animals
d. miRNA is a product of a gene
5. An RNA molecule that loops to base pair with itself is calleda.............. RNA because of its characteristic shape.
6. Suppose that you wish to target a gene using siRNA. The sensestrand of the gene that is the DNA strand codes for the mRNAcontains 21 base sequence: 5' TCGGAGCAAATAGGTAGGCA 3' What would bethe most appropriate 21 base guide strand sequence that wouldtarget the mRNA?
