1. Transcribe and translate the DNA given below. Given below is the coding strand.5'ACCTACCCATGCTCGATAAATGAAGTTCATTTTGACAAGAC 32....

60.2K

Verified Solution

Question

Biology

image

1. Transcribe and translate the DNA given below. Given below is the coding strand.5'ACCTACCCATGCTCGATAAATGAAGTTCATTTTGACAAGAC 32. Given below is the anticodon in a tRNA. What amino acid does this tRNA code for? (1)5' CAU 3'3. In a cell a certain a specific gene needs to transcribed. The cell activates this gene by acetylating histone. How is this helpful in activating the gene?

Answer & Explanation Solved by verified expert
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students