1. Which of components of the electron transport chain directlymove protons across the inner mitochondrial membrane?
2. Consider fermentation.
How much ATP is generated during fermentation?
How does the amount of ATP generated by fermentation compare toaerobic respiration?
In humans, why can't fermentation sustain life? (Hint: Think of tworeasons—one is related to the product of fermentation and whathappens if it accumulates.)
3. Given this segment of a double-stranded DNA molecule, drawthe two major steps involved in DNA replication:
ATCGGCTAGCTACGGCTATTTACGGCATAT
TAGCCGATCGATGCCGATAAATGCCGTATA
