2. (6 pts) Speculate on the effects of each of the followingmutations on the translation of the following mRNA. Specificallyindicate whether any product would be made, and if so, if it wouldbe altered in any way.  (GpppG is the 5’ cap)
5’GpppGUAACAUGGUCGGACCAUGAC(A)2003’
- Mutation that removes the editing pocket from isoleucine-tRNAsynthetase.
- Mutation that prevents GTP hydrolysis of eEF1-a.
- Mutation that prevents binding of GTP by eEF2.