3 Given the guiding region of a single guide RNA sgRNA and the double stranded...
70.2K
Verified Solution
Link Copied!
Question
Biology
3 Given the guiding region of a single guide RNA sgRNA and the double stranded DNA dsDNA in the following picture Guiding region AACGGGCGCUGGGUCGGUUA Target dsDNA TGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAG ACCACGTTGCCCGCGACCCAGCCAATGCCGGTCCTGTC a Highlight the sequence in the target dsDNA which is specifically recognized by the sgRNA b In the dsDNA indicate the region where Cas9 would cut the target dsDNA 45 X bi lactose X y plasmid ot 0 1 1 10 lac 2 of mutation
Answer & Explanation
Solved by verified expert
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!
