9. Find the restriction sites and "cut" the DNA in the sequence below. How many...
70.2K
Verified Solution
Link Copied!
Question
Biology
9. Find the restriction sites and "cut" the DNA in the sequence below. How many bands ofDNA would you see on the electrophoresis gel?BamI (CCT'AGG) --- 5' CCTAG G 3'; EcoRI (GAATTC) --- 5' GAATTC 3'3'5' ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA3'TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5'
Answer & Explanation
Solved by verified expert
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
