A short segment of DNA from a prokaryotic genome is shown below. Assume this is...

50.1K

Verified Solution

Question

Biology

image

A short segment of DNA from a prokaryotic genome is shown below. Assume this is part of a muchlonger sequence.TTAAACGCTG CCCGGCGAATTAATTTGCGAC A GGCCGCTTAAPick the correct statement from below.Mismatch repair enzymes will remove part of the strand containing the C from the TOP strand assuming the LOWER strand is more methylated.Mismatch repair enzymes will remove part of the strand containing the C from the TOP strand assuming the TOP strand is more methylated.Repair is not possible for a mutation like the one shown in the middle of this double-stranded molecule.

Answer & Explanation Solved by verified expert
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students