A third ssDNA same amount and same buffer is added in a new tube with...

60.2K

Verified Solution

Question

Biology

image

A third ssDNA same amount and same buffer is added in a new tube with the same 5000 nucleotide long single stranded DNA You repeat the same experiment and noticed that the forming of dsDNA starts immediately as soon as the cooling phase begins Curve 3 in the graph below dsDNA 100 Curve 3 Time Curve 1 Curve 2 Third ssDNA sequence TACGTACGTACGCGTACGTACGTA 2 Explain why this is happening with this last oligonucleotide but not with the first two

Answer & Explanation Solved by verified expert
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students