A third ssDNA same amount and same buffer is added in a new tube with...
60.1K
Verified Solution
Link Copied!
Question
Biology
A third ssDNA same amount and same buffer is added in a new tube with the same 5000 nucleotide long single stranded DNA You repeat the same experiment and noticed that the forming of dsDNA starts immediately as soon as the cooling phase begins Curve 3 in the graph below dsDNA 100 Curve 3 Time Curve 1 Curve 2 Third ssDNA sequence TACGTACGTACGCGTACGTACGTA 2 Explain why this is happening with this last oligonucleotide but not with the first two
Answer & Explanation
Solved by verified expert
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!
