80.2K

Verified Solution

Link Copied!

DNA 1 Develop 3 individual DNA strands that includes all 4 bases and is 50 bases long include directionality 4pts 3 Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA Strand 2 5 TACGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCT 3 Strand 3 5 GCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 2 From those 3 developed strands determine and list the consensus sequence include directionality 2pts The consensus sequence is now your DNA strand that will use for the rest of this activity Consensus Sequence 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 3 Determine the complementary strand with correct base pairing and include directionality for both strands Label strands template complementary 8pts Complementary Strand template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 Complementary Strand complementary 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 4 Show the first 6bp of your DNA going through 1 round of semi conservative replication Use different colors to represent parent and new strands 6pts 1 Original DNA Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT 3 Complementary 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 2 Semi Conservative Replication 5 Parent Strand 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCAT New Strand 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 3 5

Answer & Explanation Solved by verified expert

See Answer