Genetic Code:
Using the standard genetic code, write a sequence encoding the
peptide \"MASTERMIX\"
How many different sequences...
80.2K
Verified Solution
Link Copied!
Question
Biology
Genetic Code:
Using the standard genetic code, write a sequence encoding thepeptide \"MASTERMIX\"
How many different sequences can encode this peptide?
How many genetic codes have been described? (Hint: search NCBIGenetic Codes)
How, in a general way, do these alternative codes tend to differfrom the standard genetic code?
How is selenocysteine encoded?
Answer & Explanation
Solved by verified expert
3.8 Ratings (565 Votes)
Using the Standard Genetic Coe the Peptide MASTERMIX has the mRNA sequence 5AUGGCUUCUACUGAACGUAUGAUUUAA3 The DNA sequence for this peptide is 5ATGGCTTCTACTGAACGTATGATTTAA3 The Amino acid M is coded for by 1 codon A is coded for by 4 codons S is
See Answer
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
