RNA 1 List the 3 stages of Transcription 3pts The 3 stages of transcription are...
50.1K
Verified Solution
Link Copied!
Question
Biology
RNA 1 List the 3 stages of Transcription 3pts The 3 stages of transcription are initiation elongation and termination 2 Look at the strands from DNA question number 4 Copy and paste the DNA strand that will be used as the template for Transcription Keep in mind the direction in which DNA is transcribed 2pts Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA 3 Template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 3 Transcribe your template strand into an RNA strand with correct base pairing and directionality 6pts 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 4 Process your RNA strand by removing 3 introns totaling 30bp joining the exons and adding a Poly A tail 10pts Original RNA strand 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 3 After removing 30introns 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 3 Join the exons 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 Adding a Poly A tail 5 AUCGUACGAUCGUAGCAUCGAUCGUAGCAUCGUACAUAAAAAA 3
Answer & Explanation
Solved by verified expert
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
