Biology question and answers for December 29, 2023
- Q 1 In what ways did Churchill contribute to the start of the Cold War 2 In what ways did Stalin contribute to the start of the Cold War did Truman...
- Q 4 What do the political cartoons tell you about what these countries thought about each other during the Cold War 5 Based on everything you ve read and seen which...
- Q Drag and drop t When compal A cell placed A cell placed
- Q Highlight the statements that describe pinocytosis and receptor mediated endocytosis Select at least 4 sentences to check your answer 1 Receptor mediated endocytosis uses the protein caveolin to coat the...
- Q Term Active transport Electrochemical gradient Pump Primary active transport Secondary active transport ATP Definition The charge difference across a selectively permeable membrane Movement of ions across a membrane which is...
- Q Select the statement s that is are related to passive transport Passive transport moves molecules from an area of high concentration to an area of low concentration with the use...
- Q Drag and drop the examples to their correct category of carrier proteins Uniporter Symporter Antiporter Calcium is removed from the cell while sodium enters the cell using an exchange protein...
- Q IF a person increases his or her activity level THEN here heart heat rate will increase due Ro the bealy cells increased need for oxygen BECAUSE
- Q Drag and drop the characteristics of macromolecules to their correct category Phospholipids Proteins Carbohydrates Proteins and Carbohydrates Phospholipids and Proteins Involved in the transport of materials in or out of...
- Q Use the information you gathered from the previous page to complete the statement below You should use the open space before the box to come up with a rough draft...
- Q According to Professor Jewell President Abraham Lincoln decided to prosecute th Civil War for O Territorial reasons O Political reasons O Religious reasons
- Q cDNA can be produced from mRNA The cDNA includes Introns and promoter region Exons and promoter region O Introns and exons O Exons only
- Q All cells share the following features except All cells use proteins as catalysts O All cells translate RNA into protein the same way O All cells require ATP O All...
- Q An glycolytic pathway is one that is both catabolic and anabolic energy producing enzymatic amphibolic redox reaction
- Q For the following question please refer to Met Ala Gly His Gln Cys
- Q Which coenzyme yields the most amount of energy when converted to ATP dur the ETC and chemiosmosis Acetyl COA NADH BGH FADH2
- Q U CI PROBLEM 8 Given the following DNA sequence CGAATCCGTATGCGTACAAGCTGCTATGO 1st 2nd 3rd 1 Assume the sequence is on the coding strand a Assume that the first reading frame was...
- Q this phylum The unicellular Paramecium is often used as a model ciliate Individual Paramecium cells exchange genetic material through conjugation a non reproductive sexual process After conjugation there are no...
- Q 10 pts Please respond to one of the below prompts A B or C You may respond to multiple prompts if you wish but only one response is required Multiple...
- Q 4 What tool is used to predict the genetic outcome of offspring from parents Hint it s not 23 and me
- Q What was the significance of Hershey and Chase s findings THERE FOR V7 TEN OA They provided evidence that DNA carries heritable information OB They supported the idea that alleles...
- Q Genes store genetic information regarding which of the following A The number of DNA molecules that make up a chromosome OB The number of nucleotides needed to build a DNA...
- Q Carboxyl group QUESTION 9 What level of protein structure involves covalent and pleated sheats within a polypeptide chain
- Q H N CH C NH CH C OH CH What is being indicated by the red arrow Jonic bond CH SH
- Q QUESTION 2 Match the functional groups R Q H R G O R 910 C OH A Carboxyl B Amino C Methyl D Carbonyl E phosphate F Hydroxyl
- Q OH OH OH CH OH O Polysaccharide 0 Monosaccharide OH O OH OH OH How would you classify this molecule O Disaccharide
- Q on Completion Status Teraary Quaternary ESTION 10 ne that you are given a nurloi
- Q OH How would you classify this molecule O O 02 OH Disaccharide 3 QUESTION 6 How many fatty acid chains could potentially be joined to glycerol maximum 01 Polysaccharide Monosaccharide
- Q What type of molecule is being depicted below HHHHHHHHH FELELTHET C C C C C C C C C C H TELELI 0 0 H C O H C 0...
- Q Given the following cladogram and list of characteristics Moss Fern Conifer Flowering Plant Chlorophyll a b Yes Vascular tissue No Seeds No Flowers No Moss Fern Yes Yes No No...
- Q A prokaryote would use to move nutrients internally and eliminate waste
- Q If a cell has a damaged organelle or has some inclusion which needs digestion it will merge with a the Golgi apparatus Acceptable Formats Give me options These are small...
- Q 3 The three arcs below represent part of the cell membran a Label the cell membrane and cytoplasm for each cell b Sketch and label the following structures if present...
- Q Which of the following is NOT TRUE of dehydration synthesis O Larger molecules can be made from smaller subunits using dehydration synthesis O The breakdown of the sugar lactose into...
- Q Farmers spray pesticides on their plants to protect the Some individual insects have a genetic mutation that the pesticides Which statement best describes how or resulted in the pesticide becoming...
- Q Percentages of Nitrogenous Bases Organism A Human Chicken Rat E coli 73 2 O 28 4 O 26 6 29 4 G 28 0 29 3 20 7 20 0...
- Q Which of the following statements is FALSE Reducing agents like BME affect tertiary structure but not quaternary structure A change in protein primary structure may affect quaternary structure Increasing or...
- Q Which level of protein structure does or can involve covalent bonding tertiary O quaternary O primary All of the above None of the above 500
- Q Which of the following levels of structure will be affected by boiling Select all that apply Answer any level that is directly affected by boiling even if some aspects of...
- Q Shown below is a randomly selected internal fragment of a polypeptide i e the ends are NOT SHOWN The polypeptide is the amino N terminus and new amino acids would...
- Q Shown here is a monosaccharide HO CH C H H C HO Alpha Beta L H C C OH OH H TE anomer
- Q Which arrow s in the polypeptide shown point to peptide bond s below A B C D R A B C D both A and D N 0 R R...
- Q and 1 blotting immunoblotting by placing the phrases to the technique that they describe If a phrase describes both ELISA and western blotting place it under Both ELISA Western blot...
- Q Which of the following statements accurately describe a chromosome Select the THREE 3 that apply Chromosomes contain more than one DNA molecule linked together and then tightly wound Chromosomes contain...
- Q Facilitated diffusion requires the use of channel proteins to transport across the cell
- Q LL LUES Tools Help gine researchers following up on Seeley s study brought some flat pe bility What results could they observe that would support the hypoth results they could...
- Q Which of the following symptoms of alcohol withdrawal can be best described as convincing sensory experiences that occur in the absence of an external stimulus Multiple Choice O insomnia hallucinations...
- Q TUNA CONTENTS Submit Section 6 Graded C Darwini
- Q Q6 10 Horned lizards use their horns to defe that lizards living in areas with predatory bird predatory birds This observation led her to h against predation than do shorter...
- Q NO VARIATION in shell thickness opens to shell thickness in respons ess does not evolve in the population ess evolves for some snails in the pop ess increases for all...
- Q Name of bond it can form with another atom Give an example Give a description what happens with electrons
- Q Make a diagram of the following atoms use lecture notes as a template 1 Nitrogen atomic 7 atomic mass 14 Label protons neutrons and electrons Show their charges 3 Explain...
- Q not look different Submit JE VVCII aller fla Q6 6 Which of the following is REQUIRED occur Offspring must be similar to their parents There must be a sudden environmental...
- Q Persistent pesticides undergo choose your answer choose your answer meaning they become more concentrated as they move up a food chain meaning they build up in an organism s tissues...
- Q Match each word with its definition description Famine Malnourishment Undernourishment Extreme scarcity of food affecting an entire region Diet does not meet an individual s energy requirements An absence of...
- Q Match each type of erosion with its definition description Splash erosion Sheet erosion Rill Gully erosion Water forms channels as it carries soil away Raindrops hit bare soil loosening it...
- Q significantly to the child s adjustment to ablended family O Yes O No Question 8 1 pts Children generally adjust better to a stepparent after the death of a natural...
- Q Using the soil texture triangle how would soil with the following composition be classified 50 sand 20 clay 80 silt 10 100 20 30 sand 90 Clay 40 50 loamy...
- Q What is an agricultural ecosystem O A description of cumulative practices within a farm for food growth nutrient replacement and pest control Complex integrated living system of climate plants local...
- Q Which of the following is a concern raised by our course texts about the health safety and well being of egg donation for ART IVF purposes Psychological stress effects of...
- Q According to Alison Piepmeier the mainstream approach to disability and selective abortion including some feminist approaches reinforces stereotypes about disability How All answers are correct It promotes a view of...
- Q The statements below are true for proteins statement is true only for enzymes Check the Protein column when the statement is true about other types of proteins Some statements will...
- Q In the boxes under in a left Glucose Pyruvate
- Q What is the independent variable in the hypothesis The foot in the door selling technique is more effective than the limited time offer selling technique sales technique Osales effectiveness foot...
- Q Which of these are threats to validity in the study Professor Jones wants to study aggression in preschool children He predicts that children from poorer incomes will be more aggressive...
- Q operationalization of the depen What is a good variable in the following hypothesis Popular media increases liberal attitudes about sex How many hours of popular media do you watch a...
- Q What is xylem a plant cell type that carries out most the metabolic functions of the plant vascular plant tissue mainly consisting of tubular dead cells responsible for conducting water...
- Q Drag and drop to label the prokaryotic cell
- Q The Spanish flu outbreak which lasted from 1918 1919 was one of the most severe pandemics in recent history it is believed to have infected over 500 million and killed...
- Q mRNA amino acids Met Ala Tyr Glu Lev val 2 DNA TACCTGTTAAGCTACAAAATT mRNALAUGEACAADUC GA GUUUGAA Mat A 3 DNA AATACGGG mRNAVU amino acids amino acids amino acids 4 DNA GCTAGTACGTGCACATTAGAA...
- Q 6 In a cross of AABBCC x aabbcc what proportion of the F generation are heterozygous 01 O O O 1 3 O 1 8
- Q 1 4 points Describe the following related to water a 1 pts Describe one thing that is special about the bonds between oxygen and hydrogen in a water molecule that...
- Q In Chapter 3 we took a look at the biological macromolecules that make life possible This can be an exciting topic that gives students insights into topics such as nutrition...
- Q explain how synaptic transmission can be modified at the pre and post synaptic side
- Q explain how neurotransmitters are removed from the synaptic cleft
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!