Biology question and answers for November 21, 2023
- Q Discussion and Synthesis 11 The following image shows the steps in creating a DNA fingerprint Match the number to the description PCR amplification DNA extracted from tissue DNA fragments move...
- Q Highlight the second tRNA s anticodon the second codon and the second amino acid with the same color different from the first Arg UAC Met Pro GA Ser UCA AUGCCUAGUESGUAAA...
- Q Meb Lyr pro gly phe Soop b AUG AAG CCA GGC UUC UAA Pilet lys pro gly phe Les c AUG CCA CGA GCU UAU UGA Meb pro org ala...
- Q C 2015 Bethany Lau 5 Met Pro GGA Translation Ma LENT ever Geir duom Ser www cup of be JCA AUGCCUAGUCGGUAAAAAAAAA Arg GCC 3
- Q C 2015 Bethany Lau 5 Translation Met Pro GG Ser UCA Phase Arg GCC AUGCCUAGUCGGUAAAAAAAAA 3
- Q Name Label the diagrams as you read the following passage 25 Phase Met Pro 5 Translation Part 4 UCA Ser Arg 26 27 AUGCCUAGUCGGUAAAAAAAAA 3 The termination phase begins when...
- Q Translation Part 1 Label the diagrams as you read the following passage 3 Met UAC 4 5 5 6 THAI 1 Date 8 11 GGUA B 10 9 AUGCCUAGUCGGUAAAAAAAAA talanez...
- Q C 2015 Bethany Lau Translation Met UAC www AUGCCUAGUCGGUAAAAAAAAA Phase MERULON 3 3
- Q The central dogma of biology states that the process of O meiosis O PCR O transcription translation O evolution 4 is relevant to all of biolog
- Q 0015 Bethany Lau Translation Met Pro UCA Ser XArg Phase CO AUGCGUAGUCGGUAAAAAAAAA 3
- Q In a DNA molecule the O backbone is composed of covalently bonded bases sugars are composed of 8 carbon rings O bases are hydrogen bonded to one another O adenine...
- Q Which of these is heterozygous O AA O aa O Bb O both a and b
- Q Transcription takes place in the nucleus O in the cytoplasm O on free ribosomes O in the rough endoplasmic reticulum
- Q Following DNA amplification restriction enzymes gel electrophoresis the resultant DNA fragment band analysi called O cDNA PCR O DNA fingerprinting O vector analysis O gene therapy
- Q Transcription is the process that makes mRNA from DNA True False
- Q A genome is O All of an organism s proteins Some of an organisms DNA O All of an organisms DNA O All of an organisms RNA
- Q Is the following statement true or false multiple ribosomes can bind to an mRNA at a time and synthesize polypeptides TRUE FALSE
- Q O small satellite transmitters used in genetic research O known from Watson and Crick s 1950s research O useful for determining group but not individual identification O highly individualized repetitive...
- Q Transcription occurs in the nucleus occurs in the ribosome results in the transformation of mitochondria results in the production of proteins
- Q Is the following statement true or false All exons in a particular gene will always been included in the final mRNA transcript after splicing TRUE FALSE
- Q Which of the following are potential tRNA anticodons that would carry a serine amino acid written n 5 to 3 direction use Table 39 1 select all that apply First...
- Q Which of the following is the intermediate molecule formed before the covalent linkage of an amino acid to a tRNA O aminoacyl CoA O aminoacyl ADP
- Q Is the following statement true or false The energy required for DNA helicase activity is provided by the hydrolysis of ATP to ADP O TRUE FALSE
- Q Interactions between enhancer binding proteins and RNA polymerase II that drive transcription are facilitated by which of the following type of protein O Cis acting elements Helicases O Transcription factors...
- Q Which of the following DNA sequences are not likely to be promoter elements select all that apply TTCCAAG
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!