The following sequence of 30 nucleotides corresponds to one ofthe two strands of a double stranded DNA:
5’ GATGTGATCAGACCGGGTGCACTCTAATCT 3’
a) This sequence has two perfect palindromes that consist of 6base pairs each. What is the sequence of these two palindromes?
b) Show both strands of your FIRST palindrome (indicate the5’-3’ polarity)
c) Show both strands of your SECOND palindrome (indicate the5’-3’ polarity)
Assume that the two palindromes are recognized by “6-cutterâ€restriction enzymes, and that each enzyme creates bluntends. Assuming the 30bp DNA sequence is digested with BOTHenzymes, and that the resulting dsDNA fragments are stable (i.e.the complementary strands remain annealed):
- How many fragments would you expect upon digestion?
- How long would these fragments be (in bp)?
