Use the following mRNA codon key as needed to GCC Alanine AAU Asparagine CCU Proline...
80.2K
Verified Solution
Link Copied!
Question
Biology
Use the following mRNA codon key as needed to GCC Alanine AAU Asparagine CCU Proline GGA Glycine UGG Tryptophan UGA Stop no amino acid GAA Glutamic acid GAG Glutamic acid AGG Arginine CCC Proline CAU Histidine The following DNA sequence coding strand occurs near the middle of the coding region of a gene DNA 50 mRNA 55 50 5 AATGAATGGGAGCCTGAAGGAG 3 The corresponding mRNA sequence is shown below Note that the coding strand of DNA has the same sequence as the mRNA except that there are U s in the mRNA where there are T s in the DNA The first triplet of nucleotides AAU underlined is in frame for coding and encodes Asparagine as the codon table above indicates OA G at position 50 60 55 OC A at position 58 65 OG A at position 53 swer this 60 5 AAUGAAUGGGAGCCUGAAGGAG 3 65 Which of the following DNA mutations is almost certain to result in a shorter than normal protein
Answer & Explanation
Solved by verified expert
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!