What kinds of materials obtained from a crime scene might contain DNA? (2 pts) Consider the following...

60.2K

Verified Solution

Question

Biology

What kinds of materials obtained from a crime scene mightcontain DNA? (2 pts)

Consider the following DNA molecule

5ʹCCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG3ʹ

3ʹGGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC5ʹ

How many bp is the original fragment?(1 point)

The enzyme HaeIII has thefollowing restriction site    5ʹ GG˅CC 3ʹ         

                                                                               3ʹ CC˄GG 5ʹ

If digested with HaeIII, howmany fragments are formed if the DNA is linear? (1point)

If digested with HaeIII, howmany fragments are formed if the DNA is circular? (1point)

Consider the following DNA molecule

5ʹATTCGCGAATTCGGTACCGAATTGGCAGATTCGCCGAATTCCCGTACGGAATTAGTTAAC 3ʹ

3ʹTAAGCGCTTAAGCCATGGCTTAACCGTCTAAGCGGCTTAAGGGCATGCCTTAATCAATTG 5ʹ

How many bp is the original fragment?(1 point)

(Recognition site for EcoRIis given previously)

If digested with EcoRI, howmany fragments are formed if the DNA is linear? (1point)

If digested with EcoRI, howmany fragments are formed if the DNA is circular? (1point)

Using the results from question #2 (for linear DNA), draw theresults on a gel( “—“ = the well). Well A contains the complete,intact, undigested sample/sequence; well B contains digestedsample/sequence. (4 points)

A                B

Answer & Explanation Solved by verified expert
3.9 Ratings (438 Votes)
1 Teeth hairblood semen and various body fluids can be found in the objectsused in the crime scene Therefore such objects are collectedcarefully which may have blood stains hair semen vaginal fluidstissues or any    See Answer
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students