60.1K

Verified Solution

Link Copied!

When DNA sequences are used for phylogenetic analyses each nucleotide position can be considered a trait Using the data provided below 57 bases from the mitochondrial DNA sequences of three chameleons and one lizard map ONLY the synapomorphic traits onto the phylogenetic tree provided below Note the horizontal branch on the tree where each trait transition takes place by using a line and the number of the base base numbers can be determined using the 10 50 marks above the sequence As an example of how I want you to map the traits onto the tree I have chosen a trait that is NOT synapomorphic and mapped it onto the tree position 10 the trait in question is an A in the lizard and two species of Brookesia and transitions to G in Chamaeleo After mapping all of the synapomorphic traits count the total number of trait transitions required to support this tree and note this number next to your tree If you are not sure which traits are synapomorphic read the material in the tan box that starts on page 214 of the text and is entitled Phylogenies from DNA sequences NOTE the tree only shows the three chameleon species leaving out the lizard Uromastyx outgroup that is included in the DNA data so you can evaluate which base is ancestral for each position Uromastyx B theili B brygooi C feae 10 20 30 40 50 AAACCTTAAAAGACACCACAACCATATGAACAACAACACCAACAATCAGCACACTAC AAACACTACAAAATATAACAACTGCATGAACAACATCAACCACAGCAAACATTTTAC AAACACTACAAGACATAACAACAGCATGAACTACTTCAACAACAGCAAATATTACAC AAACCCTACGAGACGCAACAACAATATGATCCACTTCCCCCACAACAAACACAATTT Brookesia theili Brookesia brygooi

Answer & Explanation Solved by verified expert

See Answer