With very few exceptions, each state has a commission, council or board that is responsible for...

90.2K

Verified Solution

Question

Psychology

With very few exceptions, each state has a commission, councilor board that is responsible for setting the minimum qualificationsto be a public police officers in that state. Generally theseregulatory bodies are referred to as POSTs. The POST agencies issue\"certifications, or in other words, the liccense to serve as apolice officer in that state. Maryland has the Maryland PoliceTraining Commission (MPTC) While individual agencies may set theirhiring standards higher than the state's \"certification\"requirement, all applicants to be public police officers must atleast meet the standard.
No state's POST has a full four year college degree as aminimum education standard to be a public police officer.Why?

Answer & Explanation Solved by verified expert

3.7 Ratings (533 Votes)

Note This response is in UK English please paste the response to MS Word and you should be able to spot discrepancies easily You may elaborate the answer based on personal views or your classwork if necessary Answer The Peace Officers Standards Training POST See Answer

Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:

Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!

Become a Member

With very few exceptions, each state has a commission, council or board that is responsible for...

90.2K

Verified Solution

Question

Psychology

Answer & Explanation Solved by verified expert

Get Answers to Unlimited Questions

Membership Benefits:

Other questions asked by students

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is...

The diagram shows a kite AFCE inside rhombus ABCD. Angle AFB = angle AED = 35degrees,...

Determine the truth value for the following statement when p is false and q is...

c Write down the minimum height of point P 1 Later the cat is tired...

Suppose a bag contains a set of 10 tiled letters: M, T, O, A, T,...

On December 31, Strike Company sold one of its batting cages for $55,000. The equipment...

In its annual report, WAM Athletic Supply, Inc. includes the following five-year financial summary: EEB...

Using the data in the following table, calculate the return for investing in this stock...

Current Attempt in Progress Sarasota Corp. bought equipment on January 1, 2022. The equipment cost...

Determine the interest payment for the following three bonds. (Assume a $1,000 par value.) (Round...

How do you use networks to build workplace relationships providing identifiable outcomes for the team...

a nine year bond paying coupons annually has a yield of 10% and a duration...