You are amplifying the region below What is the primer sequence that would be used...
90.2K
Verified Solution
Link Copied!
Question
Biology
You are amplifying the region below What is the primer sequence that would be used to make a copy using the top strand as a template Note pretend primers are only 6 nucleotides long here normally they are 20 nucleotides long also normally you would need a primer to copy the bottom strand template as well but you are not asked for the sequence O 5 AATGAT3 5 GTTACT3 5 CAATGATTCATGGCATTGCATCGAT3 3 GTTACTAAGTACCGTAACGTAGCTA5 O 3 GTTACT5 FAISCAT
Answer & Explanation
Solved by verified expert
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!
