You are planning to use PCR to amplify several regions of apiece of DNA. The sequence of your template DNA is provided belowalong with the sequences of all available primers. Determine whereeach of the primers bind and answer the following:
5' AGGGCCAAATGAGATGAGTCAAAAGCTGCCGATAACCGGATAG 3'
3' TCCCGGTTTACTCTACTCAGTTTTCGACGGCTATTGGCCTATC 5'
Primer 1: 5-TTGGCC 3
P2: 5-GTCAAA-3
p3: 5-AACCGG-3
p4: 5-CCGGTT-3
P1 can bind to the bottom strand?
P4 can bind to the molecule at only one location
Which primer pair would you use to amplify a double stranded pcrfragment of any size from this template
Which primer has the lowest melting point
Using the two selected primers and added all of the PCRcomponents to a test tube answer the following as the polymerasechain rxn proceeds
The concentration of dNTPs will increase,decrease, stay thesame, as the rxn proceeds
The concentration of Taq DNA polymerase will increase,decrease,stay the same, as the rxn proceeds
